The tailed amplicon v1 method produced lower coverage than the ARTIC v3 method, with 98.87% coverage at a minimum of 10x and 89.40% coverage at a minimum of 100x for the 25 PCR cycle sample and 97.09% coverage at a minimum of 10x and 81.31% coverage at a minimum of 100x for the 35 PCR cycle sample (Fig. Slider with three articles shown per slide. Andersen KG, Rambaut A, Lipkin WI, Holmes EC, Garry RF. The need for informed consent was deemed unnecessary by the IRB. Article Liberibacter asiaticus was estimated using HLBaspr real-time quantitative PCR, giving a quantification threshold (Cq) value6. A) Agilent TapeStation trace for a library prepared from samples with N1 and N2 Ct values between ~2040 using the tailed amplicon v1 (2 pool amplification) workflow. Reference prophage genome sequences were at the top. 9, 357359 (2012). Show more Show more Almost yours: 2 weeks, on us. 2020;579:2703. The ARTIC network (https://artic.network/) has established a method for preparing amplicon pools in order to sequence SARS-CoV-2 (Fig. The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. It fits for example in a next-generation sequencing (NGS) or biobanking workflow with low to high throughput delivering highly precise analytical evaluation. a Samples with N1 and N2 Ct values ranging from approximately 2035 chosen for testing of SARS-CoV-2 sequencing workflows. The iVar software package was used to trim primer sequences from the aligned reads, and iVar and Samtools mpileup were used to call variants and generate consensus sequences [3]. S8). 308(2), 256262 (2018). Probable Pangolin Origin of SARS-CoV-2 Associated with the COVID-19 Outbreak. 2a-b, Supplemental Tables12). 2015;523:21720. The primary amplification was carried out in a manner similar to the ARTIC v3 method described above, using two primer pools which tile the SARS-CoV-2 genome. The resulting tree was midpoint rooted and visualized using FigTree v1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/). c The tailed amplicon approach, developed here, enriches first strand cDNA using ARTIC v3 primers containing adapter tails. This work was carried out in part using computing resources at the University of Minnesota Supercomputing Institute. The first strand synthesis reaction was incubated at 25C for 10min, 42C for 50min, 70C for 15min. Hashino M, Tanaka R, Kuroda M. A proposal of alternative primers for the ARTIC Network's multiplex PCR to improve coverage of SARS-CoV . For samples with N1 and N2 Ct vales of less than 30, average coverage was 99.92% (10x) and 99.62% (100x) at a subsampled read depth of 100,000 raw reads (Supplemental Tables12). Loop-mediated isothermal amplification (LAMP) assay for specific and rapid detection of Dickeya fangzhongdai targeting a unique genomic region, Nucleic acids enrichment of fungal pathogens to study host-pathogen interactions, Rapid Detection of Genetic Engineering, Structural Variation, and Antimicrobial Resistance Markers in Bacterial Biothreat Pathogens by Nanopore Sequencing, Multiple internal controls enhance reliability for PCR and real time PCR detection of Rathayibacter toxicus, Targeted enrichment outperforms other enrichment techniques and enables more multi-species RNA-Seq analyses, Metagenomic sequencing for detection and identification of the boxwood blight pathogen Calonectria pseudonaviculata, De novo assembly and annotation of three Leptosphaeria genomes using Oxford Nanopore MinION sequencing, Evaluation of Oxford Nanopores MinION Sequencing Device for Microbial Whole Genome Sequencing Applications, Critical steps in clinical shotgun metagenomics for the concomitant detection and typing of microbial pathogens, https://www.aphis.usda.gov/plant_health/plant_pest_info/citrus_greening/downloads/pdf_files/nationalquarantinemap.pdf, http://tree.bio.ed.ac.uk/software/figtree/, https://doi.org/10.1094/PHP-2007-0906-01-RV, https://doi.org/10.1371/journal.pone.0112968, https://doi.org/10.1094/PHYTO-08-17-0282-R, https://doi.org/10.1094/PHYTO-06-18-0185-R, http://creativecommons.org/licenses/by/4.0/, Sign up for Nature Briefing: Translational Research. A total of 1g input DNA per sample was used for SureSelect library preparation (Agilent, Santa Clara, CA). Extracted RNA from de-identified clinical biospecimens were obtained subsequent to COVID-19 testing at the University of Minnesota for use under the IRB approved protocol Detection of COVID 19 by Molecular Methods (STUDY00009560). Mesirov. Twenty-five l of the DNA libraries, bound to streptavidin beads, was amplified by PCR using SureSelect post capture primer mix and Herculase II Fusing DNA polymerase. Lab is looking to purchase an RNA QC machine similar to Agilent Bioanalyzer. https://doi.org/10.1186/s12864-020-07283-6, DOI: https://doi.org/10.1186/s12864-020-07283-6. 2019;37:1608. Emerg Infect Dis. CLas positive leaf samples from grafted trees were collected for genomic DNA extraction. $12,500 USD. 3f, Supplemental Fig. 2016;34:9429. 30(9), 13121313 (2014). B) Percentage of genome coverage at 100x at different subsampled read depths for the indicated sample when sequenced using the indicated workflow. Clark, S. A., Doyle, R., Lucidarme, J., Borrow, R. & Breuer, J. Genome Res. Sequencing data for this project is available through the National Center for Biotechnology Information (NCBI) Sequence Read Archive BioProject PRJNA631042. Select Tape Type D5000 ScreenTape assays is comparable to Bioanalyzer High Sensitivity DNA Chip Full tape and per sample options are available for the High Sensitivity D5000 and Genomic DNA tapes. Comes in most handy when a customer gives us a library that is "200-400 bases-I swear" and nothing shows up on Tape Station High Sens DNA Assay. This approach incorporates adapter tails in the ARTIC v3 primer designs, allowing sequencing libraries to be produced in a two-step PCR process, bypassing costly and labor-intensive ligation or tagmentation-based library preparation steps. The Agilent TapeStation system is an automated electrophoresis solution for the sample quality control of DNA and RNA samples. Trees were generated using RaxML v8.2.10 and visualized using FigTree v1.4.3. Nat Methods. It has a sample throughput of 12 samples per run, and results are generated in approximately 30 minutes [ 11 ]. The following indexing primers were used (X indicates the positions of the 10bp unique dual indices): Forward indexing primer: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXXXTCGTCGGCAGCGTC. All four LHCA samples are also clustered together. Comparison of the Agilent 2100 Bioanalyzer and the 4200 TapeStation The Agilent TapeStation 2200 is an intuitive system for automating RNA, DNA, and protein sample quality control and reliable electrophoresis. cDNA was amplified using each of the two ARTIC v3 primer pools which tile the SARS-CoV-2 genome. Tailed amplicon v2 pool primer sequences. We quantify and determine the integrity of your RNA or DNA prior to downstream applications such as library preparation. The Agilent TapeStation system is an automated electrophoresis solution for the sample quality control of DNA and RNA samples. Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Integrative Genomics Viewer. Consistent with previous descriptions of the ARTIC v3 primers, the balance between the tiled amplicons across these samples was relatively even, with a mean CV of 0.61 among the five patient samples tested, and 0.55 for samples with a N1 and N2 Ct of less than 30 (Fig. Tailed amplicon v1 pool primer sequences. Genome sequences of the strains sequenced in this study are available in GenBank BioProject PRJNA631042. Contigs were reordered with Abacas v1.3.132 using the CLas strain Psy62 as a reference, and then annotated with Prokka v1.1233. The following reaction was set up for non-fragmented priming of RNA: 5L template RNA and 1L NEBNext Random Primers were combined and incubated at 65C for 5min. Interestingly, LHCA contains both SC1 and SC2, meaning it has a different prophage profile and corresponds to the different clustering we observed in our phylogenetic analyses18 suggesting a potential different pathogen entry pathway. The ARTIC v3 primers have been through multiple cycles of iteration to achieve relatively even amplicon balance and genome coverage [13]. More posts you may like r/labrats Join 9 days ago Lab archetypes 512 131 r/labrats Join 28 days ago Are there any alternatives to this that anyone can recommend that is more modern tech? We sequenceda set of samples using Illuminas Nextera DNA Flex Enrichment protocol using a respiratory virus oligo panel containing probes for SARS-CoV-2, the ARTIC v3 tiled primers, and a novel tailed amplicon method designed to reduce cost and streamline the preparation of SARS-CoV-2 sequencing libraries. Google Scholar. Pools 1 and 2 were then combined, cleaned up with 1:1 AMPureXP beads (Beckman Coulter, Brea, CA)., and quantified by Qubit Fluorometer and Broad Range DNA assay (Thermo Fisher Scientific, Waltham, MA) and TapeStation capillary electrophoresis (Agilent, Santa Clara, CA). Reactions were run on a QuantStudio QS5 (Thermo Fisher Scientific, Waltham, MA) using the following cycling conditions: one cycle of 45C for 15min, followed by one cycle of 95C for 2min, followed by 45cycles of 95C for 15s and 60C for 1min. CAS To generate cDNA upstream of SARS-CoV-2 genome amplification, the following reaction was set up: 5L template RNA, 11L nuclease-free water, 4L SuperScript IV VILO master mix (Thermo Fisher Scientific, Waltham, MA). We also provide accurate quantification and sizing of NGS library. Zhang T, Wu Q, Zhang Z. 2f), consistent with prior comparisons of the USA-WA1/2020 and the Wuhan-Hu-1 reference strain. b In the ARTIC protocol, first strand cDNA is enriched by amplifying with two pools of primers to generate amplicons tiling the SARS-CoV-2 genome. W.C., conducted the experiments. 25, 19101920 (2015). The positions of all variants detected in this study are shown and bases where the sample matches the Wuhan-Hu-1 reference shown in grey. Solution hybrid selection with ultra-long oligonucleotides for massively parallel targeted sequencing. 14, 178192 (2013). While the RNA tapes are still a bit lacking, my favorite is the genomic tape so you can look at much larger sizes. I came from a lab in industry that trialed the BioA, TapeStation, Caliper system and Advanced Analytical fragment analyzer. Supplier: Agilent Technologies Accessories and spare parts for the 4150 and 4200 TapeStation systems like plates and foil seals, loading tips, TapeStation Test Tape, Needle Cartridge. The average coverage at a subsampled read depth of 100,000 raw reads was 99.89% (10x) and 75.90% (100x) for all six test samples (Supplemental Table1, Supplemental Table2). New 4200 TapeStation system with more ease of use and supportability Learn more Contact us Prior to this work, obtaining a CLas whole genome sequence was a challenge. Thus this method makes large scale sequencing of the CLas genome more cost effective and applicable. The coefficient of variation (CV) of the ARTIC v3 sample was 0.49 and the CVs of the tailed amplicon v1 samples were 1.70 and 1.26 for the 25 and 35 PCR cycle samples, respectively. All times are GMT-8. & Stulberg, M. J. The tailed amplicon method we describe represents a cost-effective and highly scalable method for SARS-CoV-2 sequencing. 2019;20:8. https://doi.org/10.1186/s13059-018-1618-7. conceived and designed the experiments and helped write the manuscript; J.G. Here we compare sequence capture and amplicon-based methods for sequencing SARS-CoV-2 and describe a streamlined tailed amplicon method for cost-effective and highly scalable SARS-CoV-2 sequencing. Croucher, N. J. et al. The tailed amplicon approach we describe bypasses costly and labor-intensive library preparation steps and will allow for production of SARS-CoV-2 libraries at high scale (similar workflows are run on tens of thousands of samples per year in the University of Minnesota Genomics Center) at low cost (between $2040 per sample depending on scale, including labor costs). 99(2), 13944 (2009). The overall workflow is depicted in Fig. As with the BEI WA isolate sample, the balance observed with the tailed amplicon v1 approach was worse than the ARTIC v3 protocol, with a mean CV of 1.81 among the six patient samples tested, and 1.28 for samples with a N1 and N2 Ct of less than 30 (Fig. S2-S3, Supplemental Tables12). More importantly, this method also effectively captures regions of diversity in the CLas genome, which provides precise molecular characterization of different strains. Liberibacter americanus and Ca. 3e, Supplemental Fig. For non-enriched samples, too few reads aligned to prophage reference sequences to estimate prophage type. As expected, since the amplicon approaches are unable to cover sequences at the ends of the SARS-CoV-2 genome, the DNA Flex Enrichment sequence capture method produced the highest genome coverage. 3b, Supplemental Fig. b Percent of the BEI WA1 isolate genome coverage at 100x at different subsampled read depths when sequenced with the indicated approach. VCF files were filtered to retain only variants sequenced to a minimum depth of coverage of 10 in enriched samples, and 3 in non-enriched samples. 2020;30:13461351.e2. Publishers note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. University of Minnesota Genomics Center, Minneapolis, MN, 55455, USA, Daryl M. Gohl,John Garbe,Patrick Grady,Jerry Daniel,Ray H. B. Watson,Benjamin Auch&Kenneth B. Beckman, Department of Genetics, Cell Biology, and Development, University of Minnesota, Minneapolis, MN, 55455, USA, Department of Lab Medicine and Pathology, Division of Molecular Pathology and Genomics, University of Minnesota, Minneapolis, MN, 55455, USA, You can also search for this author in Multilocus microsatellite analysis of Candidatus Liberibacter asiaticus associated with citrus Huanglongbing worldwide. c Observed read depth for each of the expected amplicons for the BEI WA1 isolate amplified with the ARTIC v3 protocol at a subsampled read depth of 100,000 raw reads. The Wuhan-Hu-1 SARS-CoV-2 reference genome (Accession number: MN908947) and the human GRCh38 reference genome primary assembly (Accession number: GCA_000001405.28) used in this study were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/). The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. Cite this article. For ARTIC v3 tests, based on the N1 and N2 target Ct values from clinical testing, we used either 25, 30, or 35 PCR cycles for the amplification reactions. Any one have suggestions for alternative systems for analyzing fragment sizes (other than gels)? Mass spectrometry, chromatography, spectroscopy, software, dissolution, sample handling and vacuum technologies courses, Live or on-demand webinars on product introductions, applications and software enhancements, Worldwide trade shows, conferences, local seminars and user group meetings, Service Plans, On Demand Repair, Preventive Maintenance, and Service Center Repair, Software to manage instrument access, sample processing, inventories, and more, Instrument/software qualifications, consulting, and data integrity validations, Learn essential lab skills and enhance your workflows, Instrument & equipment deinstallation, transportation, and reinstallation, CrossLab Connect services use laboratory data to improve control and decision-making, Advance lab operations with lab-wide services, asset management, relocation, Shorten the time it takes to start seeing the full value of your instrument investment. 2020:eabc0523. Plant Health Progr, https://doi.org/10.1094/PHP-2007-0906-01-RV (2007). Nucleic acids research. The CV of the tailed amplicon v2 sample was 0.52 (comparable to the CV of 0.49 with the untailed ARTIC v3 approach). Zheng, Z. et al. Gohl DM, Magli A, Garbe J, Becker A, Johnson DM, Anderson S, et al. https://doi.org/10.1038/s41579-020-0354-7. Langmead, B. Ithaca, NY 14853Email us. The findings and conclusions in this publication are those of the authors and should not be construed to represent any official USDA or U.S. Government determination or policy. Non-directional first strand cDNA synthesis was performed by combining 6l of primed template RNA, 4L NEBNext First Strand Synthesis Buffer, 2L NEBNext First Stand Synthesis Enzyme Mix, and 8L nuclease-free water. In this article, we focus on metrics relevant to evaluating the success of a Pacific Biosciences (PacBio) sequencing run. Google Scholar. Phytopathology. 2). 2017;12:12616. Gohl, D.M., Garbe, J., Grady, P. et al. Providing strain identification can help inform pathogen dissemination. It fits for example in a next-generation sequencing (NGS) or biobanking workflow with low to high throughput delivering highly precise analytical evaluation. For each CLas samples, gray graphs represent read coverage in log scale. For samples with Ct vales of less than 30, average coverage was 98.81% (10x) and 94.72% (100x) at a subsampled read depth of 100,000 raw reads (Fig. 25(15), 19681969 (2009). Assefa, S., Keane, T. M., Otto, T. D., Newbold, C. & Berriman, M. ABACAS: algorithm-based automatic contiguation of assembled sequences. Grubaugh ND, Gangavarapu K, Quick J, Matteson NL, De Jesus JG, Main BJ, et al. To obtain Science (80- ). SureSelect targeted enrichment, a new cost effective method for the whole genome sequencing of, https://doi.org/10.1038/s41598-019-55144-4. A number of different approaches have been used to sequence SARS-CoV-2. For the Illumina DNA Flex Enrichment protocol, SARS-CoV-2 genome coverage was more complete for samples with lower N1 and N2 Cts (ranging from ~2030) at comparable read depths and coverage thresholds than with amplicon approaches, similar to the BEI WA isolate data (Fig. PubMed Li, W., Hartung, J. S. & Levy, L. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. CAS S4. 3(6), https://doi.org/10.1128/genomeA.01508-15 (2015). Nat Protoc. Variants detected for the indicated sample and sequencing protocol at a read depth of up to 1,000,000 raw reads (or the maximum read depth for the sample if below 1,000,000 reads). To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Deng, X. et al. Nearly all draft genomes come from highly infected citrus or psyllids (usually with a Cq value lower than 23 using Li 16S qPCR), which limits strain diversity and epidemiology studies since not all samples can be sequenced reliably. If material is not included in the articles Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. Based on validation experiments for the University of Minnesota qRT-PCR clinical COVID-19 diagnostic assay, we estimate that a Ct value of 30 corresponds to roughly 500 SARS-CoV-2 genome copies and a Ct value of 35 corresponds to roughly 15 SARS-CoV-2 genome copies in the 5L input used for cDNA creation [18]. 55(Pt 5), 185762 (2005). In order to overcome this limitation, we present here a new method, Agilent SureSelect XT HS target enrichment, which can specifically enrich CLas from a metagenomic sample while greatly reducing cost and increasing whole genome coverage of the pathogen. 2020;26:4502. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. The Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, California) is a capillary electrophoresis-based system that can analyse DNA, RNA, and proteins. Supplemental Table2. Cornell Visualization and Imaging Partnership, Ask Us Anything About Your Needs or Projects. The secondary amplification was done using the following recipe: 5L template DNA (1:100 dilution of the first PCR reaction), 0.7L nuclease-free water, 2L 5x Q5 reaction buffer (New England Biolabs, Ipswich, MA), 0.2L 10mM dNTPs (Kapa Biosystems, Woburn, MA, 0.1L Q5 Polymerase (New England Biolabs, Ipswich, MA), 0.5L forward primer (10M), 0.5L reverse primer (10M). The Agilent system takes 30 minutes to analyse 12 samples per run whereas each ScreenTape for the tapestation can analyze 16 samples (1 sample for the library and 15 samples per tape). 10L of PCR product for each sample was normalized using a SequalPrep 96-well Normalization Plate Kit (Thermo Fisher Scientific, Waltham, MA). bioRxiv. SNPs were determined based on the alignment profile to Psy62. Percentage of genome coverage at 10x at different subsampled read depths for WA1 and UMGC SARS-CoV-2 isolates sequenced with different methods. d Observed read depth for each of the expected amplicons for the BEI WA1 isolate amplified with the tailed amplicon v1 (2 pool amplification) protocol at a subsampled read depth of 100,000 raw reads. How to Determine the DV200 of FFPE RNA Samples on the Agilent TapeStation This Information Applies To: 4200, 4150 and 2200 TapeStation, TapeStation analysis software A02.02 or higher. Liberibacter asiaticus (CLas) is the most widespread and is the only species associated with the disease in the United States (U.S.)4. For the ARTIC v3 protocol, the average coverage at a subsampled read depth of 100,000 raw reads was 98.97% (10x) and 95.14% (100x) for all five test samples. E) Mean read 1 quality score for samples prepared with the tailed amplicon v2 (4 pool amplification) workflow. Reads were discarded with a mean quality score of less than 10 or when shorter than 200 base pairs, to avoid potential probe contamination, using BBDuk v38.12 (http://bbtools.jgi.doe.gov). 2020;26. https://doi.org/10.3201/eid2610.201800. 3a for 25 or 35 PCR cycles using tailed versions of the ARTIC v3 primers split into two separate pools. Bioinformatics 27(21), 29872993 (2011). This led to decreased coverage at a given read depth for the tailed amplicon v1 method relative to ARTIC v3 (Fig. Here we describe an all-amplicon method for producing SARS-CoV-2 sequencing libraries which simplifies the process and lowers the per sample cost for sequencing SARS-CoV-2 genomes (Fig. (a) LHCA samples at different Cq values: Cq 20 (blue), Cq 22 (red), Cq 26 (gray), Cq 28 (yellow). Were interviewing these experts to gain helpful insights into their complex analysis processes. 3 and TableS4). Genome Announc, https://doi.org/10.1128/genomeA.00999-14 (2014). Google Scholar. 2a-b, Supplemental Table1, Supplemental Table2). These results indicate that this SureSelect target enrichment method can be used to sequence CLas more efficiently than the canonic NGS method. First, all DNA samples were sheared using a M220 sonicator (Covaris, Woburn, MA) (duty factor 20%, peak/Displayed Power (W) 50 and 200 cycles/burst for 30second duration time), and adaptors were ligated to end repaired DNA. Consistent with other recent analyses of SARS-CoV-2 amplicon sequencing approaches [17], we observed highly concordant results from samples with N1 and N2 Ct values of less than 30. Size distribution of each barcoded cDNA library determined on the Agilent TapeStation 2200 using the Agilent High Sensitivity D1000 ScreenTape Assay in the nasopharyngeal swab . Dai, Z. et al. 2010. http://www.bioinformatics.babraham.ac.uk/projects/fastqc/. Article Two CLas infected citrus branches containing LaHabra strain (LHCA) and San Gabriel strain (SGCA) were originally provided by California Department of Food and Agriculture (CDFA) and grafted to healthy citrus trees in the high containment green house of USDA APHIS PPQ Beltsville Laboratory. Cai, W., Yan, Z., Rascoe, J. The LHCA strain clusters most closely to the other reported California strains, AHCA1 and SGCA5, however it does form its own distinct clade from those strains too. Usually it costs at least $1500 to $3000dollars to whole genome sequence one high titer sample, but this was substantially reduced after using SureSelect target enrichment. The advantage to negative selection is it allows for the identification of new, large DNA insertions or mutations. and W.C., collected and analyzed data. Draft Genome Sequence of Candidatus Liberibacter asiaticus from California. In this study, it costs $500 per sample to obtain the whole genome, which includes $300 RNA probe per reaction and $200 sequencing price. 2020;26.1266-73. Differentiation of Candidatus Liberibacter asiaticus isolates by variable-number tandem-repeat analysis. Coverage metrics by method for sequence capture, ARTIC v3 amplicon, and tailed amplicon workflows. The annotated assemblies, as well as the 11 published genomes, were used to estimate the pan-genome with a 95% Blast ID cutoff using Roary v3.12.034. We have previously reported a substantial size bias on the MiSeq, which may help explain the preferential clustering and out-sized proportion of primer dimer reads present in the sequencing data for some samples [16]. Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples. Thorvaldsdttir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. . Next generation sequencing technologies have enabled large-scale genomic surveillance of SARS-CoV-2 as thousands of isolates are being sequenced around the world and deposited in public data repositories. Percentage of genome coverage at 100x at different subsampled read depths for WA1 and UMGC SARS-CoV-2 isolates sequenced with different methods. S8. Cookies policy. Need Help? The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA.
See My Data Welwyn Hatfield,
Outreach Everywhere Salesforce,
Articles A